A Pert Syndrome Research Papers

Porcine reproductive and respiratory syndrome (PRRS) is reported to be among the diseases with the highest economic impact in modern pig production worldwide. Yet, the economic impact of the disease at farm level is not well understood as, especially in endemically infected pig herds, losses are often not obvious. It is therefore difficult for farmers and veterinarians to appraise whether control measures such as virus elimination or vaccination will be economically beneficial for their farm. Thus, aim of this study was to develop an epidemiological and economic model to determine the costs of PRRS for an individual pig farm. In a production model that simulates farm outputs, depending on farm type, farrowing rhythm or length of suckling period, an epidemiological model was integrated. In this, the impact of PRRS infection on health and productivity was estimated. Financial losses were calculated in a gross margin analysis and a partial budget analysis based on the changes in health and production parameters assumed for different PRRS disease severities. Data on the effects of endemic infection on reproductive performance, morbidity and mortality, daily weight gain, feed efficiency and treatment costs were obtained from literature and expert opinion. Nine different disease scenarios were calculated, in which a farrow-to-finish farm (1000 sows) was slightly, moderately or severely affected by PRRS, based on changes in health and production parameters, and either in breeding, in nursery and fattening or in all three stages together. Annual losses ranged from a median of € 75′724 (90% confidence interval (C.I.): € 78′885–€ 122′946), if the farm was slightly affected in nursery and fattening, to a median of € 650′090 (90% C.I. € 603′585–€ 698′379), if the farm was severely affected in all stages. Overall losses were slightly higher if breeding was affected than if nursery and fattening were affected. In a herd moderately affected in all stages, median losses in breeding were € 46′021 and € 422′387 in fattening, whereas costs were € 25′435 lower in nursery, compared with a PRRSV-negative farm. The model is a valuable decision-support tool for farmers and veterinarians if a farm is proven to be affected by PRRS (confirmed by laboratory diagnosis). The output can help to understand the need for interventions in case of significant impact on the profitability of their enterprise. The model can support veterinarians in their communication to farmers in cases where costly disease control measures are justified.

The cause of Peutz-Jeghers syndrome (PJS) in most cases (>90%) appears to be a germline mutation of the STK11/LKB1 (serine/threonine kinase 11) tumor suppressor gene, [2]  located on chromosome 19p13. [1, 22]

STK11 is a tumor suppressor gene, in that its overexpression can induce a growth arrest of a cell at the G1 phase of the cell cycle and that somatic inactivation of the unaffected allele of STK11 is often observed in polyps and cancers from patients with Peutz-Jeghers syndrome.

STK11/LKB1 encodes a 433 amino acid ubiquitously expressed protein with a central catalytic domain and regulatory N- and C-terminal domains. The biologic function of LKB1 includes the regulation of downstream kinases, including adenosine monophosphate–activated protein kinase (AMPK) and the related kinases (microtube affinity-regulating kinase [MARK] 1 through MARK4 and brain-specific kinase/synapses of the amphid-defective kinase [Brsk/SAD]), which are involved in cellular metabolic regulation–stress response and cellular polarity, the latter through tubulin stabilization, tight junction formation, and E-cadherin localization. See the figure below.

This diagram demonstrates the role of STK11/LKB1 in neoplasia: regulation of cell polarity and metabolism. ACC = acetyl-CoA carboxylase; AMP/ATP = adenosine monophosphate/adenosine triphosphate; AMPK = AMP-activated protein kinase; CREB = CRE-binding protein; FAS = fatty acid synthase; MAPs = microtubule associated proteins; MARK = microtube affinity-regulating kinases; MO25 = calcium-binding protein 39; MRLC = myosin regulatory light chain; mTOR = mammalian target of rapamycin; SAD = synapses of the amphid-defective kinase; SIK = salt-induced kinase; STRAD = STE20-related kinase adaptor; TAU = tau protein; TORC = TOR complex; TSC 1/2 = tuberous sclerosis proteins 1 and 2.

View Media Gallery

There is evidence of interaction between the LKB1 pathway along with other tumor suppressor pathways p53 and phosphatase and tensin homologue (PTEN). Abrogation of LKB1 function results in polyposis along with loss of heterozygosity, probably a separate process, resulting in tumorigenesis.

Penetrance of the gene mutation is variable, resulting in a spectrum of phenotypic manifestations among patients with Peutz-Jeghers syndrome (eg, inconsistent number, localization of polyps, differing presentation of the macules) and allowing for a variable presentation of cancer. [11, 23, 24, 25, 26, 27, 28, 29, 30]

Data on the impact of the LKB1 mutation type and localization on disease expression are conflicting. It is believed that truncating variants in STK11 predispose to a more severe phenotype, and phenotype severity is based on an earlier onset of gastrointestinal pathology arising from the polyps (eg, intussesception, earlier onset malignancy). [1]  However, a consensus does not yet exist regarding phenotype severity based on variant location.

Schumacher and colleagues reported a higher risk of malignancy with missense mutations involving the C-terminus or exons encoding for protein domains involved in substrate recognition. [31, 32, 33]  Another report described a worse prognosis with greater polyp burden and higher risk of malignancy in individuals harboring a truncating mutation of LKB, [34]  whereas a different group failed to correlate the risk of (polyp-associated) intussusception with mutational characteristics. Overall opinion is divided on the usefulness of genotype-phenotype correlations in Peutz-Jeghers syndrome, and they are not, at present, routinely used in defining prognosis and management of the disease.

Mutation in the MYH11 gene may be implicated in a minority of patients without the LKB1 gene mutation. Hyperactivation of mammalian target of rapamycin (mTOR) signaling has also been associated with Peutz-Jeghers syndrome. [30]

Other genes may also play a role in Peutz-Jeghers syndrome, such as those that encode for the MARK protein, homologues of the Par 1 polarity protein that associates with LKB1. However, de Leng et al performed direct sequencing and probe amplification in 23 families with Peutz-Jeghers syndrome and were unable to identify any mutations in the MARK genes. [28]  This again supports the evidence that LKB1 defects remain the major cause of Peutz-Jeghers syndrome and, although other mechanisms are involved, they remain to be elucidated. [29]

An interesting study by Tobi et al demonstrated that Adnab-9, a premalignant marker found in Paneth cells, was more common in patients with Peutz-Jeghers syndrome. [35]  The authors evaluated 8 patients with Peutz-Jeghers syndrome, 8 patients with juvenile polyposis, and 36 hyperplastic polyp sections (as control subjects). The investigators found that 89% of Peutz-Jeghers syndrome polyps were labeled with Adnab-9, compared with 88% of familial juvenile polyposis sections and 11% of hyperplastic polyps. [35]  This study suggested Adnab-9 labeling may identify polyps at higher risk of malignant degeneration.

Mehenni et al, reporting on the molecular and clinical characteristics of 46 families with Peutz-Jeghers syndrome, demonstrated an increase in the mutational spectrum of LKB1/STK11 allelic variants worldwide. They suggested that this new information would be helpful for clinical diagnosis and genetic counseling. [25]

Novel de novo germline mutations associated with Peutz-Jeghers syndrome and STK11 continue to be discovered. Using Sanger sequencing,  Zhao et al identified a c.962_963delCC mutation in exon 8 in a Chinese patient with isolated Peutz-Jeghers syndrome who died of colon cancer. [36]  This mutation caused a frameshift mutation and a premature termination at codon 358. Neither of the patient's parents nor 50 control subjects had this mutation. Similarly, in a separate report, the same investigators identified a 23-nucleotide deletion (c.426-448delCGTGCCGGAGAAGCGTTTCCCAG) in exon 3 of STK11 that caused a change of 13 codons and a truncating protein (p.S142SfsX13) in another Chinese patient. None of this patient's healthy family members nor 100 control subjects exhibited the mutation. [37]

Chiang and Chen used genomic DNA to amplify and analyze the entire sequence of STK11 in 15 Taiwanese patients with Peutz-Jeghers syndrome from 11 unrelated families and found 5 novel mutations in 8 families (exon 6, c.843 ins G; exon 8, c.2065 delete A; exon 8, c.G923A, nonsense; exon 6, c.748dupA; and mTOR c.5107dupA) in addition to 3 known mutations. [38]  Two thirds (n = 10) of the patients developed malignancies, all diagnosed before age 40 years; half (n = 5) died of their cancers. Three families without detectable STK11 mutations had not developed neoplasms by the time of the report.

Jang et al reported the case of a 14-year-old Korean male with Peutz-Jeghers syndrome who had complete STK11 deletion and atypical symptoms. [39]  The use of multiplex ligation-dependent probe amplification (MLPA) rather than direct sequencing revealed heterozygous deletions spanning exons 1-10. It was unclear whether his atypical symptoms of developmental delay, mental retardation, and epilepsy without tuberous sclerosis were related to Peutz-Jeghers syndrome or to another cause given his apparently healthy parents and a sibling who did not exhibit any STK11 deletions. [39]

0 Replies to “A Pert Syndrome Research Papers”

Lascia un Commento

L'indirizzo email non verrà pubblicato. I campi obbligatori sono contrassegnati *